adaptyv
How to use the Adaptyv Bio Foundry API and Python SDK for protein experiment design, submission, and results retrieval. Use this skill whenever the user…
Biological data toolkit. Sequence analysis, alignments, phylogenetic trees, diversity metrics (alpha/beta, UniFrac), ordination (PCoA), PERMANOVA, FASTA/Newick I/O, for microbiome analysis.
$ npx -y skills add k-dense-ai/claude-scientific-skills --skill scikit-bio --agent claude-codeHow it fires
How this skill gets triggered: by you, by Claude, or both.
/scikit-bioContext preview
The summary Claude sees to decide when to auto-load this skill.
Biological data toolkit. Sequence analysis, alignments, phylogenetic trees, diversity metrics (alpha/beta, UniFrac), ordination (PCoA), PERMANOVA, FASTA/Newick I/O, for microbiome analysis.
name: scikit-bio description: Biological data toolkit. Sequence analysis, alignments, phylogenetic trees, diversity metrics (alpha/beta, UniFrac), ordination (PCoA), PERMANOVA, FASTA/Newick I/O, for microbiome analysis. license: BSD-3-Clause license allowed-tools: Read Write Edit Bash compatibility: Requires Python 3.10+ and scikit-bio 0.7+ (uv pip install scikit-bio). NumPy 2.0+ is required. Optional matplotlib/seaborn/plotly for plotting; biom-format for BIOM tables; polars/anndata for table interoperability. metadata: version: "1.2" skill-author: K-Dense Inc.
scikit-bio is a comprehensive Python library for working with biological data. Apply this skill for bioinformatics analyses spanning sequence manipulation, alignment, phylogenetics, microbial ecology, and multivariate statistics.
This skill should be used when the user:
Work with biological sequences using specialized classes for DNA, RNA, and protein data.
**Key operations:**
**Common patterns:**
import skbio
# Read sequences from file
seq = skbio.DNA.read('input.fasta')
# Sequence operations
rc = seq.reverse_complement()
rna = seq.transcribe()
protein = rna.translate()
# Find motifs
motif_positions = seq.find_with_regex('ATG[ACGT]{3}')
# Check for properties
has_degens = seq.has_degenerates()
seq_no_gaps = seq.degap()**Important notes:**
Perform pairwise and multiple sequence alignments using the `pair_align` engine (introduced in scikit-bio 0.7.0), a versatile and efficient dynamic-programming aligner.
**Key capabilities:**
**Common patterns:**
from skbio import DNA, Protein
from skbio.alignment import pair_align_nucl, pair_align_prot, pair_align, TabularMSA
# Nucleotide alignment with BLASTN-like defaults
seq1, seq2 = DNA('ACTACCAGATTACTTACGGATCAGG'), DNA('CGAAACTACTAGATTACGGATCTTA')
aln = pair_align_nucl(seq1, seq2)
aln.score # alignment score (float)
path = aln.paths[0] # PairAlignPath (repr shows CIGAR)
aligned_seqs = path.to_aligned((seq1, seq2)) # list of gapped strings
# Build a TabularMSA from the alignment path + original sequences
msa = TabularMSA.from_path_seqs(path, (seq1, seq2))
# Customize the algorithm via pair_align (default mode='global')
aln = pair_align(seq1, seq2, mode='local') # Smith-Waterman
aln = pair_align(seq1, seq2, sub_score=(2, -3), gap_cost=(5, 2)) # affine gaps
aln = pair_align(seq1, seq2, sub_score='NUC.4.4', gap_cost=3) # substitution matrix, linear gap
# Protein alignment (BLASTP-like, BLOSUM62)
aln = pair_align_prot(Protein('HEAGAWGHEE'), Protein('PAWHEAE'))
# Read a multiple alignment from file and summarize
msa = TabularMSA.read('alignment.fasta', constructor=DNA)
consensus = msa.consensus()**Important notes:**
Construct, manipulate, and analyze phylogenetic trees representing evolutionary relationships.
**Key capabilities:**
**Common patterns:**
from skbio import TreeNode
from skbio.tree import nj, upgma, gme, bme, rf_dists
# Read tree from file
tree = TreeNode.read('tree.nwk')
# Construct tree from distan🔔 Claude Scientific Skills is now Scientific Agent Skills. Same skills, broader compatibility — now works with any AI agent that supports the open Agent Skills standard, not just Claude.
How to use the Adaptyv Bio Foundry API and Python SDK for protein experiment design, submission, and results retrieval. Use this skill whenever the user…
This skill should be used for time series machine learning tasks including classification, regression, clustering, forecasting, anomaly detection,…
Plan, execute, and document validation, verification, and transfer of analytical procedures under the governing framework - ICH Q2(R2) and Q14, USP…
Data structure for annotated matrices in single-cell analysis. Use when working with .h5ad files or integrating with the scverse ecosystem. This is the data…
Autonomously improve a real artifact (code, training recipe, agent harness, data pipeline, prompt) against an objective and an evaluator, using Hypothesis Tree…
Infer gene regulatory networks (GRNs) from gene expression data using scalable algorithms (GRNBoost2, GENIE3). Use when analyzing transcriptomics data (bulk…