/bio-crispr-screens-library-design
CRISPR library design for genetic screens. Covers sgRNA selection, library composition, control design, and oligo ordering. Use when designing custom sgRNA libraries for knockout, activation, or interference screens.
$ npx -y skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-crispr-screens-library-design --agent claude-codeHow it fires
How this skill gets triggered: by you, by Claude, or both.
- Fires itselfAuto-invocation. Claude auto-loads it when your prompt matches the work.Auto-invocation is when the right skill fires by itself at the right moment, driven by a FLOW.md router and a hook, instead of you invoking it by name. It is the difference between a skill being installed and a skill actually getting used.Read the full definition →
- You can call itInvoke it directly when you want it.
- Slash command
/bio-crispr-screens-library-design
Context preview
The summary Claude sees to decide when to auto-load this skill.
CRISPR library design for genetic screens. Covers sgRNA selection, library composition, control design, and oligo ordering. Use when designing custom sgRNA libraries for knockout, activation, or interference screens.
SKILL.md
bio-crispr-screens-library-design.SKILL.mdname: bio-crispr-screens-library-design
description: CRISPR library design for genetic screens. Covers sgRNA selection, library composition, control design, and oligo ordering. Use when designing custom sgRNA libraries for knockout, activation, or interference screens.
tool_type: python
primary_tool: crispor
Version Compatibility
Reference examples tested with: BioPython 1.83+, MAGeCK 0.5+, numpy 1.26+, pandas 2.2+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
Library Design
**"Design a custom CRISPR library for my screen"** → Select optimal sgRNAs for knockout, CRISPRi/a, or base editing libraries with on-target scoring, off-target filtering, and control guide design.
- Python: CRISPOR-based scoring with `BioPython` for sequence handling
sgRNA Selection Criteria
**Goal:** Score and rank candidate sgRNAs for a target gene based on design quality metrics.
**Approach:** Scan the gene sequence for PAM sites, extract 20-nt protospacer sequences, score each on GC content, poly-T avoidance, 5' G preference, and length, then return the top-ranked candidates.
import pandas as pd
import numpy as np
from Bio import SeqIO
from Bio.Seq import Seq
def score_sgrna(sequence, pam='NGG'):
'''Score sgRNA based on multiple criteria.'''
scores = {}
gc_content = (sequence.count('G') + sequence.count('C')) / len(sequence)
scores['gc_content'] = 1 - abs(gc_content - 0.5) * 2
if len(sequence) >= 4:
has_poly_t = 'TTTT' in sequence
scores['poly_t'] = 0 if has_poly_t else 1
starts_with_g = sequence.startswith('G')
scores['start_g'] = 1 if starts_with_g else 0.5
scores['length'] = 1 if len(sequence) == 20 else 0.8
overall = np.mean(list(scores.values()))
return overall, scores
def design_sgrnas_for_gene(gene_sequence, n_guides=4, pam='NGG'):
'''Design sgRNAs targeting a gene.'''
candidates = []
pam_pattern = pam.replace('N', '[ACGT]')
import re
for strand in ['+', '-']:
seq = gene_sequence if strand == '+' else str(Seq(gene_sequence).reverse_complement())
for match in re.finditer(f'([ACGT]{{20}})({pam_pattern})', seq):
sgrna = match.group(1)
position = match.start()
if strand == '-':
position = len(seq) - position - 23
score, details = score_sgrna(sgrna)
candidates.append({
'sequence': sgrna,
'pam': match.group(2),
'strand': strand,
'position': position,
'score': score,
'gc_content': (sgrna.count('G') + sgrna.count('C')) / 20,
**details
})
candidates_df = pd.DataFrame(candidates)
candidates_df = candidates_df.sort_values('score', ascending=False)
return candidates_df.head(n_guides)
gene_seq = 'ATGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGG'
guides = design_sgrnas_for_gene(gene_seq, n_guides=5)
print(guides[['sequence', 'position', 'strand', 'score', 'gc_content']])Library Composition
**Goal:** Assemble a complete sgRNA library targeting a list of genes with appropriate controls.
**Approach:** Design top-scoring guides for each gene, append non-targeting, essential-control, and safe-harbor-control guides, and compile into an ordered library table.
def design_library(gene_list, guides_per_gene=4, include_controls=True):
'''Design complete library for gene list.'''
library = []
for gene in gene_list:
gene_data = get_gene_sequence(gene)
guides = design_sgrnas_for_gene(gene_data['sequence'], n_guides=guides_per_gene)
for idx, guide in guides.iterrows():
library.append({
'gene': gene,
'gene_id': gene_data.get('ensembl_id', ''),
'guide_number': idx + 1,
'sequence': guide['sequence'],
'pam': guide['pam'],
'position': guide['position'],
'strand': guide['strand'],
'score': guide['score'],
'type': 'targeting'
})
if include_controls:
controls = design_control_guides()
library.extend(controls)
return pd.DataFrame(library)
def get_gene_sequence(gene_name):
'''Fetch gene sequence (placeholder - use Ensembl API or local files).'''
return {
'sequence': 'ATGC' * 250,
'ensembl_id': f'ENSG_{hash(gene_name) % 100000:05d}'
}
genes = ['TP53', 'BRCA1', 'KRAS', 'MYC', 'CDK4']
library = design_library(genes, guides_per_gene=4)
print(f'Library size: {len(library)} guides')
print(f'Genes: {library["gene"].nunique()}')Control Guide Design
**Goal:** Design control guide sets for normalization and quality assessment in CRISPR screens.
**Approach:** Generate random non-targeting sequences with acceptable GC content, add validated guides against known essential genes (positive controls) and safe-harbor loci (negative controls).
def design_control_guides(n_nontargeting=100, n_essential=20, n_nonessential=20):
'''Design control guides for library.'''
controls = []
for i in range(n_nontargeting):
sequence = generate_nontargeting_sequence()
controls.append({
'gene': f'NonTargeting_{i+1}',
'gene_id': '',
'guide_number': 1,
'sequence': sequence,
'pam': 'NGG',
'position': -1,
'strand': '',
'score': 0,
'type': 'non-targeting'
})
essential_genes = ['RPS3', 'RPL11', 'EIF3A', 'POLR2A', 'CDK1']
for gene in essential_genes[:n_essentRead more
name: bio-crispr-screens-library-design description: CRISPR library design for genetic screens. Covers sgRNA selection, library composition, control design, and oligo ordering. Use when designing custom sgRNA libraries for knockout, activation, or interference screens. tool_type: python primary_tool: crispor
Version Compatibility
Reference examples tested with: BioPython 1.83+, MAGeCK 0.5+, numpy 1.26+, pandas 2.2+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
Library Design
**"Design a custom CRISPR library for my screen"** → Select optimal sgRNAs for knockout, CRISPRi/a, or base editing libraries with on-target scoring, off-target filtering, and control guide design.
- Python: CRISPOR-based scoring with `BioPython` for sequence handling
sgRNA Selection Criteria
**Goal:** Score and rank candidate sgRNAs for a target gene based on design quality metrics.
**Approach:** Scan the gene sequence for PAM sites, extract 20-nt protospacer sequences, score each on GC content, poly-T avoidance, 5' G preference, and length, then return the top-ranked candidates.
import pandas as pd
import numpy as np
from Bio import SeqIO
from Bio.Seq import Seq
def score_sgrna(sequence, pam='NGG'):
'''Score sgRNA based on multiple criteria.'''
scores = {}
gc_content = (sequence.count('G') + sequence.count('C')) / len(sequence)
scores['gc_content'] = 1 - abs(gc_content - 0.5) * 2
if len(sequence) >= 4:
has_poly_t = 'TTTT' in sequence
scores['poly_t'] = 0 if has_poly_t else 1
starts_with_g = sequence.startswith('G')
scores['start_g'] = 1 if starts_with_g else 0.5
scores['length'] = 1 if len(sequence) == 20 else 0.8
overall = np.mean(list(scores.values()))
return overall, scores
def design_sgrnas_for_gene(gene_sequence, n_guides=4, pam='NGG'):
'''Design sgRNAs targeting a gene.'''
candidates = []
pam_pattern = pam.replace('N', '[ACGT]')
import re
for strand in ['+', '-']:
seq = gene_sequence if strand == '+' else str(Seq(gene_sequence).reverse_complement())
for match in re.finditer(f'([ACGT]{{20}})({pam_pattern})', seq):
sgrna = match.group(1)
position = match.start()
if strand == '-':
position = len(seq) - position - 23
score, details = score_sgrna(sgrna)
candidates.append({
'sequence': sgrna,
'pam': match.group(2),
'strand': strand,
'position': position,
'score': score,
'gc_content': (sgrna.count('G') + sgrna.count('C')) / 20,
**details
})
candidates_df = pd.DataFrame(candidates)
candidates_df = candidates_df.sort_values('score', ascending=False)
return candidates_df.head(n_guides)
gene_seq = 'ATGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGG'
guides = design_sgrnas_for_gene(gene_seq, n_guides=5)
print(guides[['sequence', 'position', 'strand', 'score', 'gc_content']])Library Composition
**Goal:** Assemble a complete sgRNA library targeting a list of genes with appropriate controls.
**Approach:** Design top-scoring guides for each gene, append non-targeting, essential-control, and safe-harbor-control guides, and compile into an ordered library table.
def design_library(gene_list, guides_per_gene=4, include_controls=True):
'''Design complete library for gene list.'''
library = []
for gene in gene_list:
gene_data = get_gene_sequence(gene)
guides = design_sgrnas_for_gene(gene_data['sequence'], n_guides=guides_per_gene)
for idx, guide in guides.iterrows():
library.append({
'gene': gene,
'gene_id': gene_data.get('ensembl_id', ''),
'guide_number': idx + 1,
'sequence': guide['sequence'],
'pam': guide['pam'],
'position': guide['position'],
'strand': guide['strand'],
'score': guide['score'],
'type': 'targeting'
})
if include_controls:
controls = design_control_guides()
library.extend(controls)
return pd.DataFrame(library)
def get_gene_sequence(gene_name):
'''Fetch gene sequence (placeholder - use Ensembl API or local files).'''
return {
'sequence': 'ATGC' * 250,
'ensembl_id': f'ENSG_{hash(gene_name) % 100000:05d}'
}
genes = ['TP53', 'BRCA1', 'KRAS', 'MYC', 'CDK4']
library = design_library(genes, guides_per_gene=4)
print(f'Library size: {len(library)} guides')
print(f'Genes: {library["gene"].nunique()}')Control Guide Design
**Goal:** Design control guide sets for normalization and quality assessment in CRISPR screens.
**Approach:** Generate random non-targeting sequences with acceptable GC content, add validated guides against known essential genes (positive controls) and safe-harbor loci (negative controls).
def design_control_guides(n_nontargeting=100, n_essential=20, n_nonessential=20):
'''Design control guides for library.'''
controls = []
for i in range(n_nontargeting):
sequence = generate_nontargeting_sequence()
controls.append({
'gene': f'NonTargeting_{i+1}',
'gene_id': '',
'guide_number': 1,
'sequence': sequence,
'pam': 'NGG',
'position': -1,
'strand': '',
'score': 0,
'type': 'non-targeting'
})
essential_genes = ['RPS3', 'RPL11', 'EIF3A', 'POLR2A', 'CDK1']
for gene in essential_genes[:n_essentThe largest open-source medical AI skill library for OpenClaw.
Other skills on openclaw-medical-skills.
adaptyv
Cloud laboratory platform for automated protein testing and validation. Use when designing proteins and needing experimental validation including binding…
adhd-daily-planner
Time-blind friendly planning, executive function support, and daily structure for ADHD brains. Specializes in realistic time estimation, dopamine-aware task…
aeon
This skill should be used for time series machine learning tasks including classification, regression, clustering, forecasting, anomaly detection,…
agent-browser
Browse the web for any task — research topics, read articles, interact with web apps, fill forms, take screenshots, extract data, and test web pages. Use…

