/bio-crispr-screens-base-editing-analysis
Analyzes base editing and prime editing outcomes including editing efficiency, bystander edits, and indel frequencies. Use when quantifying CRISPR base editor results, comparing ABE vs CBE efficiency, or assessing prime editing fidelity.
$ npx -y skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-crispr-screens-base-editing-analysis --agent claude-codeHow it fires
How this skill gets triggered: by you, by Claude, or both.
- Fires itselfAuto-invocation. Claude auto-loads it when your prompt matches the work.Auto-invocation is when the right skill fires by itself at the right moment, driven by a FLOW.md router and a hook, instead of you invoking it by name. It is the difference between a skill being installed and a skill actually getting used.Read the full definition →
- You can call itInvoke it directly when you want it.
- Slash command
/bio-crispr-screens-base-editing-analysis
Context preview
The summary Claude sees to decide when to auto-load this skill.
Analyzes base editing and prime editing outcomes including editing efficiency, bystander edits, and indel frequencies. Use when quantifying CRISPR base editor results, comparing ABE vs CBE efficiency, or assessing prime editing fidelity.
SKILL.md
bio-crispr-screens-base-editing-analysis.SKILL.mdname: bio-crispr-screens-base-editing-analysis
description: Analyzes base editing and prime editing outcomes including editing efficiency, bystander edits, and indel frequencies. Use when quantifying CRISPR base editor results, comparing ABE vs CBE efficiency, or assessing prime editing fidelity.
tool_type: python
primary_tool: CRISPResso2
Version Compatibility
Reference examples tested with: CRISPResso2 2.2+, pandas 2.2+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
Base Editing Analysis
**"Analyze my base editing outcomes"** → Quantify base editing efficiency, bystander edits, and indel frequencies from amplicon sequencing data for CBE, ABE, and prime editing experiments.
- CLI: `CRISPResso --fastq_r1 reads.fq --amplicon_seq ATGC --base_editor_output`
CRISPResso2 for Base Editing
**Goal:** Quantify base editing efficiency and bystander edits from amplicon sequencing.
**Approach:** Run CRISPResso with --base_editor_output and the expected edited amplicon sequence to measure target base conversion, bystander edits, and indel frequencies.
# Analyze base editing with expected outcome
CRISPResso --fastq_r1 reads.fq.gz \
--amplicon_seq ATGCGATCGATCGATCGATCGATCG \
--guide_seq TCGATCGATCGATCGAT \
--expected_hdr_amplicon_seq ATGCGATCGATCGTTCGATCGATCG \
--base_editor_output \
-o results/Key Metrics
| Metric | Description | |--------|-------------| | Editing efficiency | % reads with target base change | | Bystander edits | Unintended edits in editing window | | Indel frequency | Insertions/deletions (should be low) | | Purity | Target edit without bystanders |
Base Editor Types
Cytosine Base Editors (CBE)
# C->T conversion (or G->A on opposite strand)
CRISPResso --fastq_r1 reads.fq.gz \
--amplicon_seq $AMPLICON \
--guide_seq $GUIDE \
--base_editor_output \
--conversion_nuc_from C \
--conversion_nuc_to TAdenine Base Editors (ABE)
# A->G conversion (or T->C on opposite strand)
CRISPResso --fastq_r1 reads.fq.gz \
--amplicon_seq $AMPLICON \
--guide_seq $GUIDE \
--base_editor_output \
--conversion_nuc_from A \
--conversion_nuc_to GPrime Editing Analysis
# Prime editing with pegRNA
CRISPResso --fastq_r1 reads.fq.gz \
--amplicon_seq $AMPLICON \
--guide_seq $SPACER \
--expected_hdr_amplicon_seq $EDITED_AMPLICON \
--prime_editing_pegRNA_extension_seq $EXTENSION \
-o prime_edit_results/Editing Window Analysis
import pandas as pd
# Load CRISPResso quantification
quant = pd.read_csv('CRISPResso_output/Quantification_window_nucleotide_percentage_table.txt',
sep='\t')
# Calculate per-position editing
editing_window = quant[(quant['Position'] >= -5) & (quant['Position'] <= 5)]Quality Thresholds
- Editing efficiency: >30% considered good for most applications
- Indel rate: <5% ideal for base editors
- Bystander rate: depends on application; <10% often acceptable
Related Skills
- crispr-screens/crispresso-editing - General editing QC
- crispr-screens/library-design - Guide design considerations
- variant-calling/vcf-basics - Downstream variant analysis
Read more
name: bio-crispr-screens-base-editing-analysis description: Analyzes base editing and prime editing outcomes including editing efficiency, bystander edits, and indel frequencies. Use when quantifying CRISPR base editor results, comparing ABE vs CBE efficiency, or assessing prime editing fidelity. tool_type: python primary_tool: CRISPResso2
Version Compatibility
Reference examples tested with: CRISPResso2 2.2+, pandas 2.2+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
Base Editing Analysis
**"Analyze my base editing outcomes"** → Quantify base editing efficiency, bystander edits, and indel frequencies from amplicon sequencing data for CBE, ABE, and prime editing experiments.
- CLI: `CRISPResso --fastq_r1 reads.fq --amplicon_seq ATGC --base_editor_output`
CRISPResso2 for Base Editing
**Goal:** Quantify base editing efficiency and bystander edits from amplicon sequencing.
**Approach:** Run CRISPResso with --base_editor_output and the expected edited amplicon sequence to measure target base conversion, bystander edits, and indel frequencies.
# Analyze base editing with expected outcome
CRISPResso --fastq_r1 reads.fq.gz \
--amplicon_seq ATGCGATCGATCGATCGATCGATCG \
--guide_seq TCGATCGATCGATCGAT \
--expected_hdr_amplicon_seq ATGCGATCGATCGTTCGATCGATCG \
--base_editor_output \
-o results/Key Metrics
| Metric | Description | |--------|-------------| | Editing efficiency | % reads with target base change | | Bystander edits | Unintended edits in editing window | | Indel frequency | Insertions/deletions (should be low) | | Purity | Target edit without bystanders |
Base Editor Types
Cytosine Base Editors (CBE)
# C->T conversion (or G->A on opposite strand)
CRISPResso --fastq_r1 reads.fq.gz \
--amplicon_seq $AMPLICON \
--guide_seq $GUIDE \
--base_editor_output \
--conversion_nuc_from C \
--conversion_nuc_to TAdenine Base Editors (ABE)
# A->G conversion (or T->C on opposite strand)
CRISPResso --fastq_r1 reads.fq.gz \
--amplicon_seq $AMPLICON \
--guide_seq $GUIDE \
--base_editor_output \
--conversion_nuc_from A \
--conversion_nuc_to GPrime Editing Analysis
# Prime editing with pegRNA
CRISPResso --fastq_r1 reads.fq.gz \
--amplicon_seq $AMPLICON \
--guide_seq $SPACER \
--expected_hdr_amplicon_seq $EDITED_AMPLICON \
--prime_editing_pegRNA_extension_seq $EXTENSION \
-o prime_edit_results/Editing Window Analysis
import pandas as pd
# Load CRISPResso quantification
quant = pd.read_csv('CRISPResso_output/Quantification_window_nucleotide_percentage_table.txt',
sep='\t')
# Calculate per-position editing
editing_window = quant[(quant['Position'] >= -5) & (quant['Position'] <= 5)]Quality Thresholds
- Editing efficiency: >30% considered good for most applications
- Indel rate: <5% ideal for base editors
- Bystander rate: depends on application; <10% often acceptable
Related Skills
- crispr-screens/crispresso-editing - General editing QC
- crispr-screens/library-design - Guide design considerations
- variant-calling/vcf-basics - Downstream variant analysis
The largest open-source medical AI skill library for OpenClaw.
Other skills on openclaw-medical-skills.
adaptyv
Cloud laboratory platform for automated protein testing and validation. Use when designing proteins and needing experimental validation including binding…
adhd-daily-planner
Time-blind friendly planning, executive function support, and daily structure for ADHD brains. Specializes in realistic time estimation, dopamine-aware task…
aeon
This skill should be used for time series machine learning tasks including classification, regression, clustering, forecasting, anomaly detection,…
agent-browser
Browse the web for any task — research topics, read articles, interact with web apps, fill forms, take screenshots, extract data, and test web pages. Use…

