Skip to content
Data
Skill

/bio-codon-usage

<!--

From plugin
openclaw-medical-skills
3k200 skills
Install
$ npx -y skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-codon-usage --agent claude-code

How it fires

How this skill gets triggered: by you, by Claude, or both.

  • Fires itselfAuto-invocation. Claude auto-loads it when your prompt matches the work.Auto-invocation is when the right skill fires by itself at the right moment, driven by a FLOW.md router and a hook, instead of you invoking it by name. It is the difference between a skill being installed and a skill actually getting used.Read the full definition →
  • You can call itInvoke it directly when you want it.
  • Slash command/bio-codon-usage

Context preview

The summary Claude sees to decide when to auto-load this skill.

<!--

SKILL.md

bio-codon-usage.SKILL.md

<!--

COPYRIGHT NOTICE

This file is part of the "Universal Biomedical Skills" project.

Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>

All Rights Reserved.

#

This code is proprietary and confidential.

Unauthorized copying of this file, via any medium is strictly prohibited.

#

Provenance: Authenticated by MD BABU MIA

-->

--- name: bio-codon-usage description: Analyze codon usage, calculate CAI (Codon Adaptation Index), and examine synonymous codon bias using Biopython. Use when analyzing coding sequences for expression optimization or evolutionary analysis. tool_type: python primary_tool: Bio.SeqUtils.CodonUsage measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools:

  • read_file
  • run_shell_command

---

Codon Usage

Analyze codon usage patterns and calculate codon adaptation metrics using Biopython.

Required Imports

from Bio.Seq import Seq
from Bio.SeqUtils import GC123
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
from Bio.Data import CodonTable
from collections import Counter

Basic Codon Counting

Count Codons in Sequence

from collections import Counter

def count_codons(seq):
    seq_str = str(seq).upper()
    codons = [seq_str[i:i+3] for i in range(0, len(seq_str) - 2, 3)]
    return Counter(codons)

seq = Seq('ATGCGATCGATCGATCGTAA')
codon_counts = count_codons(seq)

Codon Frequencies (Relative)

def codon_frequencies(seq):
    counts = count_codons(seq)
    total = sum(counts.values())
    return {codon: count / total for codon, count in counts.items()}

Codon Adaptation Index (CAI)

Using CodonUsage Module

from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex

# Create CAI calculator with reference set
cai = CodonAdaptationIndex()

# Generate index from highly expressed genes
cai.generate_index('highly_expressed_genes.fasta')

# Calculate CAI for a sequence
seq = Seq('ATGCGATCGATCGATCGTAA')
cai_value = cai.cai_for_gene(str(seq))
print(f'CAI: {cai_value:.3f}')  # Range 0-1, higher = better adapted

CAI with Custom Codon Index

from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex

cai = CodonAdaptationIndex()

# Set custom index (relative adaptiveness for each codon)
custom_index = {
    'TTT': 0.5, 'TTC': 1.0,  # Phe
    'TTA': 0.1, 'TTG': 0.5, 'CTT': 0.3, 'CTC': 1.0, 'CTA': 0.1, 'CTG': 1.0,  # Leu
    # ... define all 64 codons
}
cai.set_cai_index(custom_index)

Synonymous Codon Usage

RSCU (Relative Synonymous Codon Usage)

RSCU = (observed codon frequency) / (expected frequency if all synonymous codons were used equally)

from Bio.Data import CodonTable

def calculate_rscu(seq, table_id=1):
    codon_table = CodonTable.unambiguous_dna_by_id[table_id]
    counts = count_codons(seq)

    # Group codons by amino acid
    aa_to_codons = {}
    for codon in counts:
        if codon in codon_table.stop_codons:
            continue
        try:
            aa = codon_table.forward_table[codon]
            aa_to_codons.setdefault(aa, []).append(codon)
        except KeyError:
            continue

    # Calculate RSCU for each codon
    rscu = {}
    for aa, codons in aa_to_codons.items():
        total = sum(counts.get(c, 0) for c in codons)
        n_synonymous = len(codons)
        expected = total / n_synonymous if n_synonymous > 0 else 0
        for codon in codons:
            observed = counts.get(codon, 0)
            rscu[codon] = observed / expected if expected > 0 else 0
    return rscu

Identify Rare Codons

def find_rare_codons(seq, threshold=0.1):
    freq = codon_frequencies(seq)
    return {codon: f for codon, f in freq.items() if f < threshold}

Codon Bias by Position (GC123)

from Bio.SeqUtils import GC123

seq = Seq('ATGCGATCGATCGATCGATCGATCGATCGTAA')
gc_total, gc_pos1, gc_pos2, gc_pos3 = GC123(seq)

print(f'Total GC: {gc_total:.1f}%')
print(f'1st position GC: {gc_pos1:.1f}%')
print(f'2nd position GC: {gc_pos2:.1f}%')
print(f'3rd position GC: {gc_pos3:.1f}% (wobble position)')

Codon Tables

Access Codon Tables

from Bio.Data import CodonTable

# Get standard table
std_table = CodonTable.unambiguous_dna_by_id[1]

# List all available tables
for id, table in CodonTable.unambiguous_dna_by_id.items():
    print(f'{id}: {table.names[0]}')

Common Codon Tables

| ID | Name | Organism | |----|------|----------| | 1 | Standard | Most organisms | | 2 | Vertebrate Mitochondrial | Human, mouse mito | | 4 | Mold Mitochondrial | Fungi, protozoa mito | | 5 | Invertebrate Mitochondrial | Insects, worms mito | | 11 | Bacterial/Plastid | E. coli, chloroplasts |

Codon Table Properties

table = CodonTable.unambiguous_dna_by_id[1]

print(f'Start codons: {table.start_codons}')
print(f'Stop codons: {table.stop_codons}')

# Forward table: codon -> amino acid
print(table.forward_table['ATG'])  # 'M'

# Back table: amino acid -> list of codons
back_table = {}
for codon, aa in table.forward_table.items():
    back_table.setdefault(aa, []).append(codon)
print(f'Leucine codons: {back_table["L"]}')

Code Patterns

Full Codon Usage Report

def codon_usage_report(seq, table_id=1):
    from Bio.Data import CodonTable

    table = CodonTable.unambiguous_dna_by_id[table_id]
    counts = count_codons(seq)
    total = sum(counts.values())

    # Group by amino acid
    aa_groups = {}
    for codon, aa in table.forward_table.items():
        aa_groups.setdefault(aa, []).append(codon)

    report = {}
    for aa, codons in sorted(aa_groups.items()):
        aa_total = sum(counts.get(c, 0) for c in codons)
        report[aa] = {
            'total': aa_total,
            'codons': {c: {'count': counts.get(c, 0),
                          'freq': counts.get(c, 0) / aa_total if aa_total > 0 else 0}
                      for c in codons}
        }
    return report

Compare Codon Usage Be

Read more
Ships withopenclaw-medical-skills

The largest open-source medical AI skill library for OpenClaw.

Get the whole plugin
Stats
3,000
Stars
407
Forks
Maintained
Maintenance
Python
Language
1mo ago
Last commit
6mo ago
Created

Repo: FreedomIntelligence/OpenClaw-Medical-Skills

Other skills on openclaw-medical-skills.