/bio-codon-usage
<!--
$ npx -y skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-codon-usage --agent claude-codeHow it fires
How this skill gets triggered: by you, by Claude, or both.
- Fires itselfAuto-invocation. Claude auto-loads it when your prompt matches the work.Auto-invocation is when the right skill fires by itself at the right moment, driven by a FLOW.md router and a hook, instead of you invoking it by name. It is the difference between a skill being installed and a skill actually getting used.Read the full definition →
- You can call itInvoke it directly when you want it.
- Slash command
/bio-codon-usage
Context preview
The summary Claude sees to decide when to auto-load this skill.
<!--
SKILL.md
bio-codon-usage.SKILL.md<!--
COPYRIGHT NOTICE
This file is part of the "Universal Biomedical Skills" project.
Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
All Rights Reserved.
#
This code is proprietary and confidential.
Unauthorized copying of this file, via any medium is strictly prohibited.
#
Provenance: Authenticated by MD BABU MIA
-->
--- name: bio-codon-usage description: Analyze codon usage, calculate CAI (Codon Adaptation Index), and examine synonymous codon bias using Biopython. Use when analyzing coding sequences for expression optimization or evolutionary analysis. tool_type: python primary_tool: Bio.SeqUtils.CodonUsage measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools:
- read_file
- run_shell_command
---
Codon Usage
Analyze codon usage patterns and calculate codon adaptation metrics using Biopython.
Required Imports
from Bio.Seq import Seq
from Bio.SeqUtils import GC123
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
from Bio.Data import CodonTable
from collections import Counter
Basic Codon Counting
Count Codons in Sequence
from collections import Counter
def count_codons(seq):
seq_str = str(seq).upper()
codons = [seq_str[i:i+3] for i in range(0, len(seq_str) - 2, 3)]
return Counter(codons)
seq = Seq('ATGCGATCGATCGATCGTAA')
codon_counts = count_codons(seq)Codon Frequencies (Relative)
def codon_frequencies(seq):
counts = count_codons(seq)
total = sum(counts.values())
return {codon: count / total for codon, count in counts.items()}Codon Adaptation Index (CAI)
Using CodonUsage Module
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
# Create CAI calculator with reference set
cai = CodonAdaptationIndex()
# Generate index from highly expressed genes
cai.generate_index('highly_expressed_genes.fasta')
# Calculate CAI for a sequence
seq = Seq('ATGCGATCGATCGATCGTAA')
cai_value = cai.cai_for_gene(str(seq))
print(f'CAI: {cai_value:.3f}') # Range 0-1, higher = better adaptedCAI with Custom Codon Index
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
cai = CodonAdaptationIndex()
# Set custom index (relative adaptiveness for each codon)
custom_index = {
'TTT': 0.5, 'TTC': 1.0, # Phe
'TTA': 0.1, 'TTG': 0.5, 'CTT': 0.3, 'CTC': 1.0, 'CTA': 0.1, 'CTG': 1.0, # Leu
# ... define all 64 codons
}
cai.set_cai_index(custom_index)Synonymous Codon Usage
RSCU (Relative Synonymous Codon Usage)
RSCU = (observed codon frequency) / (expected frequency if all synonymous codons were used equally)
from Bio.Data import CodonTable
def calculate_rscu(seq, table_id=1):
codon_table = CodonTable.unambiguous_dna_by_id[table_id]
counts = count_codons(seq)
# Group codons by amino acid
aa_to_codons = {}
for codon in counts:
if codon in codon_table.stop_codons:
continue
try:
aa = codon_table.forward_table[codon]
aa_to_codons.setdefault(aa, []).append(codon)
except KeyError:
continue
# Calculate RSCU for each codon
rscu = {}
for aa, codons in aa_to_codons.items():
total = sum(counts.get(c, 0) for c in codons)
n_synonymous = len(codons)
expected = total / n_synonymous if n_synonymous > 0 else 0
for codon in codons:
observed = counts.get(codon, 0)
rscu[codon] = observed / expected if expected > 0 else 0
return rscuIdentify Rare Codons
def find_rare_codons(seq, threshold=0.1):
freq = codon_frequencies(seq)
return {codon: f for codon, f in freq.items() if f < threshold}Codon Bias by Position (GC123)
from Bio.SeqUtils import GC123
seq = Seq('ATGCGATCGATCGATCGATCGATCGATCGTAA')
gc_total, gc_pos1, gc_pos2, gc_pos3 = GC123(seq)
print(f'Total GC: {gc_total:.1f}%')
print(f'1st position GC: {gc_pos1:.1f}%')
print(f'2nd position GC: {gc_pos2:.1f}%')
print(f'3rd position GC: {gc_pos3:.1f}% (wobble position)')Codon Tables
Access Codon Tables
from Bio.Data import CodonTable
# Get standard table
std_table = CodonTable.unambiguous_dna_by_id[1]
# List all available tables
for id, table in CodonTable.unambiguous_dna_by_id.items():
print(f'{id}: {table.names[0]}')Common Codon Tables
| ID | Name | Organism | |----|------|----------| | 1 | Standard | Most organisms | | 2 | Vertebrate Mitochondrial | Human, mouse mito | | 4 | Mold Mitochondrial | Fungi, protozoa mito | | 5 | Invertebrate Mitochondrial | Insects, worms mito | | 11 | Bacterial/Plastid | E. coli, chloroplasts |
Codon Table Properties
table = CodonTable.unambiguous_dna_by_id[1]
print(f'Start codons: {table.start_codons}')
print(f'Stop codons: {table.stop_codons}')
# Forward table: codon -> amino acid
print(table.forward_table['ATG']) # 'M'
# Back table: amino acid -> list of codons
back_table = {}
for codon, aa in table.forward_table.items():
back_table.setdefault(aa, []).append(codon)
print(f'Leucine codons: {back_table["L"]}')Code Patterns
Full Codon Usage Report
def codon_usage_report(seq, table_id=1):
from Bio.Data import CodonTable
table = CodonTable.unambiguous_dna_by_id[table_id]
counts = count_codons(seq)
total = sum(counts.values())
# Group by amino acid
aa_groups = {}
for codon, aa in table.forward_table.items():
aa_groups.setdefault(aa, []).append(codon)
report = {}
for aa, codons in sorted(aa_groups.items()):
aa_total = sum(counts.get(c, 0) for c in codons)
report[aa] = {
'total': aa_total,
'codons': {c: {'count': counts.get(c, 0),
'freq': counts.get(c, 0) / aa_total if aa_total > 0 else 0}
for c in codons}
}
return reportCompare Codon Usage Be
Read more
<!--
COPYRIGHT NOTICE
This file is part of the "Universal Biomedical Skills" project.
Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
All Rights Reserved.
#
This code is proprietary and confidential.
Unauthorized copying of this file, via any medium is strictly prohibited.
#
Provenance: Authenticated by MD BABU MIA
-->
--- name: bio-codon-usage description: Analyze codon usage, calculate CAI (Codon Adaptation Index), and examine synonymous codon bias using Biopython. Use when analyzing coding sequences for expression optimization or evolutionary analysis. tool_type: python primary_tool: Bio.SeqUtils.CodonUsage measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools:
- read_file
- run_shell_command
---
Codon Usage
Analyze codon usage patterns and calculate codon adaptation metrics using Biopython.
Required Imports
from Bio.Seq import Seq from Bio.SeqUtils import GC123 from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex from Bio.Data import CodonTable from collections import Counter
Basic Codon Counting
Count Codons in Sequence
from collections import Counter
def count_codons(seq):
seq_str = str(seq).upper()
codons = [seq_str[i:i+3] for i in range(0, len(seq_str) - 2, 3)]
return Counter(codons)
seq = Seq('ATGCGATCGATCGATCGTAA')
codon_counts = count_codons(seq)Codon Frequencies (Relative)
def codon_frequencies(seq):
counts = count_codons(seq)
total = sum(counts.values())
return {codon: count / total for codon, count in counts.items()}Codon Adaptation Index (CAI)
Using CodonUsage Module
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
# Create CAI calculator with reference set
cai = CodonAdaptationIndex()
# Generate index from highly expressed genes
cai.generate_index('highly_expressed_genes.fasta')
# Calculate CAI for a sequence
seq = Seq('ATGCGATCGATCGATCGTAA')
cai_value = cai.cai_for_gene(str(seq))
print(f'CAI: {cai_value:.3f}') # Range 0-1, higher = better adaptedCAI with Custom Codon Index
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
cai = CodonAdaptationIndex()
# Set custom index (relative adaptiveness for each codon)
custom_index = {
'TTT': 0.5, 'TTC': 1.0, # Phe
'TTA': 0.1, 'TTG': 0.5, 'CTT': 0.3, 'CTC': 1.0, 'CTA': 0.1, 'CTG': 1.0, # Leu
# ... define all 64 codons
}
cai.set_cai_index(custom_index)Synonymous Codon Usage
RSCU (Relative Synonymous Codon Usage)
RSCU = (observed codon frequency) / (expected frequency if all synonymous codons were used equally)
from Bio.Data import CodonTable
def calculate_rscu(seq, table_id=1):
codon_table = CodonTable.unambiguous_dna_by_id[table_id]
counts = count_codons(seq)
# Group codons by amino acid
aa_to_codons = {}
for codon in counts:
if codon in codon_table.stop_codons:
continue
try:
aa = codon_table.forward_table[codon]
aa_to_codons.setdefault(aa, []).append(codon)
except KeyError:
continue
# Calculate RSCU for each codon
rscu = {}
for aa, codons in aa_to_codons.items():
total = sum(counts.get(c, 0) for c in codons)
n_synonymous = len(codons)
expected = total / n_synonymous if n_synonymous > 0 else 0
for codon in codons:
observed = counts.get(codon, 0)
rscu[codon] = observed / expected if expected > 0 else 0
return rscuIdentify Rare Codons
def find_rare_codons(seq, threshold=0.1):
freq = codon_frequencies(seq)
return {codon: f for codon, f in freq.items() if f < threshold}Codon Bias by Position (GC123)
from Bio.SeqUtils import GC123
seq = Seq('ATGCGATCGATCGATCGATCGATCGATCGTAA')
gc_total, gc_pos1, gc_pos2, gc_pos3 = GC123(seq)
print(f'Total GC: {gc_total:.1f}%')
print(f'1st position GC: {gc_pos1:.1f}%')
print(f'2nd position GC: {gc_pos2:.1f}%')
print(f'3rd position GC: {gc_pos3:.1f}% (wobble position)')Codon Tables
Access Codon Tables
from Bio.Data import CodonTable
# Get standard table
std_table = CodonTable.unambiguous_dna_by_id[1]
# List all available tables
for id, table in CodonTable.unambiguous_dna_by_id.items():
print(f'{id}: {table.names[0]}')Common Codon Tables
| ID | Name | Organism | |----|------|----------| | 1 | Standard | Most organisms | | 2 | Vertebrate Mitochondrial | Human, mouse mito | | 4 | Mold Mitochondrial | Fungi, protozoa mito | | 5 | Invertebrate Mitochondrial | Insects, worms mito | | 11 | Bacterial/Plastid | E. coli, chloroplasts |
Codon Table Properties
table = CodonTable.unambiguous_dna_by_id[1]
print(f'Start codons: {table.start_codons}')
print(f'Stop codons: {table.stop_codons}')
# Forward table: codon -> amino acid
print(table.forward_table['ATG']) # 'M'
# Back table: amino acid -> list of codons
back_table = {}
for codon, aa in table.forward_table.items():
back_table.setdefault(aa, []).append(codon)
print(f'Leucine codons: {back_table["L"]}')Code Patterns
Full Codon Usage Report
def codon_usage_report(seq, table_id=1):
from Bio.Data import CodonTable
table = CodonTable.unambiguous_dna_by_id[table_id]
counts = count_codons(seq)
total = sum(counts.values())
# Group by amino acid
aa_groups = {}
for codon, aa in table.forward_table.items():
aa_groups.setdefault(aa, []).append(codon)
report = {}
for aa, codons in sorted(aa_groups.items()):
aa_total = sum(counts.get(c, 0) for c in codons)
report[aa] = {
'total': aa_total,
'codons': {c: {'count': counts.get(c, 0),
'freq': counts.get(c, 0) / aa_total if aa_total > 0 else 0}
for c in codons}
}
return reportCompare Codon Usage Be
The largest open-source medical AI skill library for OpenClaw.
Other skills on openclaw-medical-skills.
adaptyv
Cloud laboratory platform for automated protein testing and validation. Use when designing proteins and needing experimental validation including binding…
adhd-daily-planner
Time-blind friendly planning, executive function support, and daily structure for ADHD brains. Specializes in realistic time estimation, dopamine-aware task…
aeon
This skill should be used for time series machine learning tasks including classification, regression, clustering, forecasting, anomaly detection,…
agent-browser
Browse the web for any task — research topics, read articles, interact with web apps, fill forms, take screenshots, extract data, and test web pages. Use…

